rs11767486 chr7:101803627 A>G
- Sequence
tggtgaatgcaatgttctaatagc[A/G]atgaaacagagttattgaaggaga
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 2.04 | -1.84 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, comorbid depressive syndrome and alcohol dependence, fasting blood glucose, hdl cholesterol, longstanding arthritis, refractive error, rheumatoid arthritis, type 2 diabetes, gender differentiated