rs11767658 chr7:154640535 T>A
- Sequence
tgtcataaggccattgatgagaaa[T/A]tagccaattaattcattgcaaata
- ASB in cell types
- K562 (myelogenous leukemia) GM12891 (male B- cells lymphoblastoid cell line) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.11 | 0.47 | 1.55 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -2.02 | 1.89 | 1.00 | |||
| LNCaP (prostate carcinoma) | 1.59 | -0.57 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, irritible bowel syndrome, mitral annular calcium, multiple sclerosis (progressive multiple sclerosis)