rs11767846 chr7:68548151 T>G
- Sequence
aatccctcaccaggacacatgcct[T/G]caggagtctgacgtacttaaccca
- ASB for transcription factors
- CUX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CUX1_HUMAN | -2.26 | 3.06 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1