rs117679591 chr12:67069230 G>A
- Sequence
gcgccggggctgttcagcggggct[G/A]gggcgccgaggcggctcccgggca
- ASB in cell types
- pancreas gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 1.59 | -0.76 | 1.00 | |||
| gastroesophageal sphincter | -1.24 | 1.60 | 1.00 |
Items per page:
1 – 2 of 2