rs11769115 chr7:37690458 T>C
- Sequence
tttcacagtgcgacgtgcctgctc[T/C]tgctttgccttccacagtgagtaa
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood CD14+ monocytes
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.36 | 2.22 | 1.55 | n/a | No Hit | |||
| STAT1_HUMAN | 1.91 | -0.87 | 2.00 | -1.38 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood