rs11769821 chr7:132534182 G>A
- Sequence
gaattcacactgaaacagaaagcc[G/A]gtcagcttcaacaaggagaggata
- ASB in cell types
- MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.71 | -1.91 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic ever smokers), decrease in fev1 (in asthmatic participants >=30 years old), decrease in fev1 (in asthmatic participants), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), triglycerides change with statins