rs11770623 chr7:45112056 G>C
- Sequence
gtgggataggcgacgttgaggcct[G/C]tgggggctgggaggacgagtgagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) gastroesophageal sphincter tibial nerve thoracic aorta
- ASB for transcription factors
- CTCF_HUMAN BMI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.57 | 0.09 | 1.18 | 3.44 | Discordant | |||
| BMI1_HUMAN | -2.28 | 2.65 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
