rs11771930 chr7:158616199 A>G
- Sequence
taacatagttaacatcttacttac[A/G]taactgtttttagatgtaatagcg
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) MSC (mesenchymal stem cells)
- ASB for transcription factors
- ZN843_HUMAN PKNX1_HUMAN SP7_HUMAN PRDM6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN843_HUMAN | n/a | 3.37 | 2.00 | n/a | n/a | |||
| PKNX1_HUMAN | n/a | 2.12 | 2.00 | n/a | No Hit | |||
| SP7_HUMAN | n/a | 3.22 | 2.00 | n/a | No Hit | |||
| PRDM6_HUMAN | n/a | 1.64 | 2.00 | n/a | No Hit | |||
| ZNF34_HUMAN | n/a | 2.55 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood