rs11772674 chr7:158395242 C>A
- Sequence
cgcaggcgcggtctcgacctgaat[C/A]ccccgtgcgggcacctgcgcccag
- ASB in cell types
- CUTLL1 (T-cell lymphoblastic lymphoma 1) WA09 (embryonic stem cells) A549 (lung carcinoma) prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 2.05 | -2.92 | 1.50 | |||
| WA09 (embryonic stem cells) | 1.15 | -0.42 | 1.25 | |||
| A549 (lung carcinoma) | 1.02 | 0.14 | 2.00 | |||
| prostate gland | -1.49 | 1.80 | 1.00 |
Items per page:
1 – 4 of 4