rs11775501 chr8:100452842 T>C
- Sequence
gagaaatgtgtcatttgatgattt[T/C]gttattgtgcaaccatcatagagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) JB6 (Human anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.79 | 1.05 | 1.09 | |||
| JB6 (Human anaplastic large cell lymphoma) | n/a | 1.60 | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, major depressive disorder (broad definition), major depressive disorder (broad definition) (males)