rs11775551 chr8:9092501 A>G
- Sequence
taggtgaagatgtcaggaaataag[A/G]tttgctcttgtcatgggtaaacag
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.62 | -3.60 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, diastolic blood pressure (dbp), nicotine dependence (smoking), smoking cessation in a trial of precessation nicotine replacement, parkinsons disease, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood