rs117775110 chr8:26449216 C>T
- Sequence
ccgagcatctccagccacaggatt[C/T]cccgggggagcgtccccgagcgga
- ASB in cell types
- GBM39 (Human brain tumor) monocytes from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GBM39 (Human brain tumor) | 1.96 | -0.68 | 2.00 | |||
| monocytes from periferal blood | 2.03 | n/a | 2.50 |
Items per page:
1 – 2 of 2