rs117829971 chr8:65864693 C>T
- Sequence
ggaaccacttccatgttcttcctt[C/T]tctcctgcccatactcgctcaggc
- ASB in cell types
- esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| esophagus squamous epithelium | -2.02 | 2.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg