rs117849278 chr11:83414021 C>T
- Sequence
aagctctgtagttttactagatcc[C/T]atttgttgattttggcttttgttg
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.51 | -4.74 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid