rs117868697 chr6:125769770 G>T
- Sequence
tgcatgactgatggaatgaggaag[G/T]aatgaatgaacgtcatatgctgaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | -2.75 | 0.84 | 2.00 | -3.88 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
