rs117912948 chr21:36087972 G>T
- Sequence
ccctctgctagctgccctcaggag[G/T]atctggggcctgccagagttagct
- ASB for transcription factors
- ZN316_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN316_HUMAN | 2.63 | -1.31 | 1.00 | -3.17 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
