rs117923859 chr19:10483882 G>C
- Sequence
gattacaggcacatgccaccacgg[G/C]cagctaatttttgtatttttagta
- ASB in cell types
- foreskin keratinocyte GM19193 (female B-cells Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell) neural cell
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.66 | 0.36 | 1.50 | -3.63 | Concordant | |||
| STAG1_HUMAN | 2.03 | 0.52 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg