rs117940210 chr17:75589275 G>A
- Sequence
cgggccacgggcgagcgaggggtg[G/A]ggccgccggaaaccggacgagggg
- ASB in cell types
- uterus right lobe of liver GM19238 (female B-cells lymphoblastoid cell lines) breast tumor
- ASB for transcription factors
- ESR1_HUMAN SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.85 | 0.41 | 2.00 | n/a | No Hit | |||
| SRBP2_HUMAN | 1.83 | -0.20 | 3.00 | 1.75 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Whole_Blood