rs117981338 chr17:73092704 C>T
- Sequence
cccgcagtcacttcctgcttccct[C/T]ccgcacacgtggccctcccgcctc
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN XBP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 3.87 | n/a | 2.00 | 3.45 | Discordant | |||
| XBP1_HUMAN | -0.29 | 1.78 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood