rs118022281 chr12:42144728 C>G
- Sequence
gcggagggaggggcaccgcgcagc[C/G]gcgggcgcaacaagttcctcaccc
- ASB in cell types
- breast tumor CD14+ monocytes iPSC (induced pluripotent stem cells) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- STAT1_HUMAN ESR1_HUMAN AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.60 | -4.25 | 2.00 | n/a | No Hit | |||
| ESR1_HUMAN | 3.07 | -0.09 | 1.75 | n/a | No Hit | |||
| AP2A_HUMAN | 2.25 | -1.83 | 1.00 | -4.12 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood