rs118037481 chr19:3988038 C>T
- Sequence
tttttttttttttttttttaagac[C/T]aagtctcgctctgttgccacgctg
- ASB in cell types
- 22RV1 (prostate carcinoma) GSC23 (Glioblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -0.76 | 2.21 | 1.00 | |||
| GSC23 (Glioblastoma) | 2.42 | -2.08 | 1.00 |
Items per page:
1 – 2 of 2