rs118141562 chr1:35192273 G>C
- Sequence
gcggccgccgggcccgccgggcgg[G/C]ggcccctggtgatgctgctggtgg
- ASB in cell types
- fetal bone marrow-derived mononuclear cells primary B-CLL cells
- ASB for transcription factors
- KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | -4.37 | 2.47 | 1.50 | 2.93 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid