rs118182877 chr17:49032293 C>T
- Sequence
agaaaatgtcccctgctgataggt[C/T]tctggttgctccaggaccttagag
- ASB in cell types
- glioblastoma cells epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -0.88 | 0.88 | 1.00 | |||
| epidermal keratinocytes | 1.98 | -0.90 | 2.00 |
Items per page:
1 – 2 of 2