rs12042883 chr1:31413316 C>T
- Sequence
cctgctcagctgcgtgagtcccga[C/T]cccggcgcccgcccgcgcgcgccg
- ASB in cell types
- breast tumor HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- NELFE_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NELFE_HUMAN | 2.47 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid