rs120626 chr6:33280098 A>T
- Sequence
tctcaccctctccagcagggggga[A/T]cctgaccctctccaggagagggaa
- ASB in cell types
- foreskin keratinocyte HCT-116 (colon carcinoma) GM12890 (Lymphoblastoid Cell Lines) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.91 | n/a | 2.83 | |||
| HCT-116 (colon carcinoma) | 1.00 | 0.33 | 1.06 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.29 | -0.95 | 1.00 | |||
| PC9 (lung adenocarcinoma) | 2.27 | 0.74 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood