rs12144628 chr1:160540148 C>A
- Sequence
cagaaagcactggagaaacactag[C/A]gaaatttatcttctcaaacggttg
- ASB in cell types
- K562 (myelogenous leukemia) TF-1 (erythroleukemia) adult erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.36 | 0.79 | 2.11 | |||
| TF-1 (erythroleukemia) | -0.33 | 1.56 | 1.50 | |||
| adult erythroblasts | 1.17 | 0.21 | 3.00 |
Items per page:
1 – 3 of 3