rs12145816 chr1:208652536 G>T
- Sequence
aaaatctctccccctttcccaagc[G/T]aatctagatcctttcagaagcaaa
- ASB in cell types
- THP-1 (acute monocytic leukemia) neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 1.05 | 0.13 | 2.00 | |||
| neutrophils | 1.84 | -1.38 | 1.50 |
Items per page:
1 – 2 of 2