rs12146552 chr11:102925273 G>A
- Sequence
tttacttctctggcggctagaggc[G/A]gaaagtcacattctaagaatatga
- ASB in cell types
- monocyte-derived dendritic cells macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 0.32 | 1.85 | 1.25 | |||
| macrophages form periferal blood | 1.65 | -0.46 | 2.00 |
Items per page:
1 – 2 of 2