rs12146572 chr11:104332221 A>G
- Sequence
ttttcttcagggactcagaatctt[A/G]ttcagactatgaagaaccagggtc
- ASB in cell types
- epithelial cell of prostate foreskin keratinocyte Peyer's patch H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -1.86 | 2.21 | 1.00 | |||
| foreskin keratinocyte | 2.01 | -1.27 | 2.25 | |||
| Peyer's patch | n/a | 2.30 | 1.00 | |||
| H929 (plasma cell myeloma) | n/a | 2.58 | 3.00 |
Items per page:
1 – 4 of 4