rs12148708 chr15:75092056 G>A
- Sequence
ttacacatttgacaaggctgtgga[G/A]caactggaactctcatacactgct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN IKZF1_HUMAN IKZF2_HUMAN SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.46 | 2.29 | 1.00 | n/a | n/a | |||
| IKZF1_HUMAN | n/a | 2.52 | 2.00 | n/a | n/a | |||
| IKZF2_HUMAN | -1.40 | 1.92 | 1.00 | n/a | n/a | |||
| SRF_HUMAN | -2.41 | 2.65 | 1.00 | n/a | No Hit | |||
| IRF4_HUMAN | -0.92 | 1.46 | 1.00 | -1.64 | Weak Discordant |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood