rs12148953 chr16:12289488 G>A
- Sequence
ggatacctcgtttcccatttcctg[G/A]tgaggtcaccaccctctccggtgg
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 1.38 | 0.15 | 2.06 | |||
| HepG2 (hepatoblastoma) | 0.95 | 0.38 | 2.96 |
Items per page:
1 – 2 of 2