rs12149123 chr16:84603197 T>C
- Sequence
ccagttttccttccccgtggactt[T/C]aacaacactccagcccgcaagcct
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia) macrophages MDM(monocyte derived macrophages)
- ASB for transcription factors
- ERG_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERG_HUMAN | -0.12 | 2.79 | 1.42 | n/a | No Hit | |||
| CEBPB_HUMAN | 2.03 | -0.79 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2