rs12150079 chr17:39869164 G>A

Sequence
cccccaaccaaattgtaggacgtt[G/A]tctttatgagcctggcattcagta
ASB in cell types
GM12878 (female B-cells lymphoblastoid cell line)
ASB for transcription factors
FOXK2_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (G) ASB
color scale alt
-log10 FDR of Alt (A) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
FOXK2_HUMAN 2.17 n/a 0.031.00 1.00 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

GRASP advanced age-related macular degeneration advanced age-related macular degeneration (choroidal neovascularization) vs. no amd advanced age-related macular degeneration (geographic atrophy) asthma asthma (childhood asthma) asthma, childhood and later onset asthma, childhood onset asthma, childhood, later and unknown onset, and severe and industrial asthma asthma, childhood, later and unknown onset, and severe asthma barnes akathisia rating scale biploar disorder (bipolar schizoaffective disorder) chronic kidney disease college completion hdl cholesterol irritible bowel syndrome ldl cholesterol microalbuminuria multiple myeloma serum creatinine severe asthma tardive dyskinesia transmission distortion type 1 diabetes type 1 diabetes, combined control dataset waist hip ratio
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Coronary Artery_Tibial Brain_Frontal_Cortex_BA9 Breast_Mammary_Tissue Cells_Cultured_fibroblasts Cells_EBV-transformed_lymphocytes Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Lung Muscle_Skeletal Nerve_Tibial Pancreas Pituitary Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Small_Intestine_Terminal_Ileum Spleen Stomach Testis Thyroid Whole_Blood

Download