rs12150464 chr17:45699005 C>T
- Sequence
ggaagaaagcgaggagatttgatt[C/T]ctctcttcctctctttcctgtcct
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.95 | -0.22 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, diastolic blood pressure (dbp), height, infant head circumference, intracranial volume, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), parkinsons disease, red blood cell count (rbc), systolic blood pressure (sbp), waist hip ratio, years of education