rs12150957 chr19:863892 G>C
- Sequence
cactgtactccgacctgggtgaca[G/C]agcgagactctgtctcaaaacaaa
- ASB in cell types
- gastroesophageal sphincter K562 (myelogenous leukemia) Peyer's patch 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.01 | 1.70 | 1.20 | n/a | No Hit | |||
| STAG1_HUMAN | 0.29 | 1.12 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood