rs12151923 chr20:57469781 T>C
- Sequence
ctgaagatcgcaaattagcagctc[T/C]atgtaagaataatggcacggtgca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.05 | 0.60 | 1.20 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), barnes akathisia rating scale, chronic kidney disease, hdl cholesterol, hip bone mineral density (bmd), ldl cholesterol, parkinsons disease, serum creatinine, total cholesterol, total cholesterol change with statins