rs12153783 chr5:158946979 A>T
- Sequence
ctggaacttcccagtggctttgtt[A/T]acactgtgaggggaaaaacatcta
- ASB in cell types
- GM17942 (lymphoblastoid cell) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 2.45 | -2.12 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 1.09 | -1.02 | 1.00 |
Items per page:
1 – 2 of 2