rs12154421 chr7:82740483 A>G
- Sequence
tgctggagcaggggactctagcag[A/G]atatgtctagaaaagcaaagatgg
- ASB in cell types
- neural cell THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.36 | 1.05 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.84 | 0.80 | 1.00 |
Items per page:
1 – 2 of 2