rs12159200 chr22:40646087 A>C
- Sequence
ccaggggaaactaggaagcttggt[A/C]tccctacccagcgaccttgatttg
- ASB in cell types
- GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | -0.44 | 1.31 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, drotrecogin alfa treatment response to severe sepsis, mitral annular calcium, parkinsons disease
PheWAS abnormal serum enzyme levels, acquired deformities of ankle and foot, acquired foot deformities, acquired hemolytic anemias, acute osteomyelitis, acute periodontitis, alcoholism, anemia nos, anemia of chronic disease, benign neoplasm of skin, calcium/phosphorus disorders, cellulitis and abscess of face, chondrocalcinosis, chronic prostatitis, chronic venous hypertension, complications of gastrostomy, colostomy and enterostomy, congenital anomalies of face and neck, crystal arthropathies, diseases of the larynx and vocal cords, disorders of mineral metabolism, disturbances of sensation of smell and taste, dysmetabolic syndrome x, eosinophilia, epilepsy, recurrent seizures, convulsions, esophageal cancer, eustachian tube disorders, failure to thrive, fracture of ribs, functional disorders of bladder, hallux valgus (bunion), heart transplant/surgery, hx of malignant neoplasm of oral cavity and pharynx, hypercalcemia, hyperosmolality and/or hypernatremia, joint/ligament sprain, keratoconjunctivitis sicca, keratoconjunctivitis, noninfectious, lump or mass in breast, lung involvement in conditions classified elsewhere, nodular lymphoma, noninflammatory disorders of ovary, fallopian tube, & broad ligament, nonrheumatic aortic valve disorders, osteomyelitis, other acute and subacute forms of ischemic heart disease, other disorders of intestine, other disorders of the kidney and ureters, other hypertensive complications, paralytic ileus, phlebitis and thrombophlebitis of lower extremities, postmenopausal hormone replacement, prostatitis, pulmonary collapse, interstitial/compensatory emphysema, secondary malignancy of bone, skin neoplasm of uncertain behavior, spermatocele, subarachnoid hemorrhage (injury), subdural hemorrhage (injury), superficial cellulitis and abscess, symptoms involving head and neck, symptoms involving respiratory system, symptoms involving urinary system, unspecified osteomyelitis, vascular complications of surgery and medical procedures, ventricular fibrillation & flutter, wheezing
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood