rs12170538 chr22:21045993 G>C
- Sequence
tgcgagagggtcgtaaccatgagg[G/C]gttcctgtgagaggtctggggagg
- ASB in cell types
- breast tumor GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 3.16 | n/a | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.08 | -0.01 | 1.06 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Lung, Pituitary, Prostate, Testis