rs12174713 chr6:6724859 G>A
- Sequence
agaaagacaggcaggggagggggc[G/A]atccctccaactccaaagctgtgc
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM14 (Adult acute myeloid leukemia) | 0.93 | -0.07 | 2.00 | |||
| foreskin keratinocyte | 1.07 | -2.85 | 2.33 |
Items per page:
1 – 2 of 2