rs12187928 chr5:42927983 G>T
- Sequence
ctgttgacctgtttactgtctcgt[G/T]tctcaccaagtcggactaccattg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TBX21_HUMAN BHE40_HUMAN IKZF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | 3.50 | n/a | 1.00 | 1.14 | Weak Discordant | |||
| BHE40_HUMAN | 2.71 | -4.09 | 1.33 | -2.53 | Concordant | |||
| IKZF1_HUMAN | 2.94 | 0.08 | 1.33 | n/a | n/a | |||
| IKZF2_HUMAN | 2.25 | -1.69 | 1.00 | n/a | n/a | |||
| COT1_HUMAN | 2.15 | -1.86 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, infant head circumference, parkinsons disease, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Stomach, Testis