rs12189702 chr6:147510030 A>C
- Sequence
tggaggcaataaggtgctaaggac[A/C]tcagagataatcgggccacaggat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.70 | 0.37 | 1.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, amyotrophic lateral sclerosis (als), fasting insulin, homa-ir, microalbuminuria, refractive error, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio, waist hip ratio