rs12190287 chr6:133893387 C>G
- Sequence
tccaagggctgagaacttcggtga[C/G]ttcatccacctgtctatttgcaca
- ASB in cell types
- A673 (Ewing sarcoma)
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 2.27 | -1.94 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI coronary artery disease, coronary artery disease or ischemic stroke, coronary artery disease or large artery stroke, coronary heart disease, lung function (fev1/fvc), medication use (diuretics)
GRASP coronary artery disease (cad), coronary artery disease (cad) (females), coronary artery disease (cad) (males), coronary artery disease (cad) (men), coronary artery disease (cad) (women), coronary artery disease (cad) age <=50, coronary artery disease (cad) age >50, coronary artery disease (cad) by angiography, coronary artery disease (cad) with age of onset <=50, coronary artery disease (cad) with age of onset >50, coronary artery disease (cad) with myocardial infarction (mi), gene expression of tcf21 in liver, gene expression of tcf21 in omental adipose, heart rate, ldl cholesterol, myocardial infarction (mi), obesity with early age of onset (age >2), pericardial fat, rheumatoid arthritis, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Uterus