rs12192568 chr6:27772659 C>A
- Sequence
cccaggaagccggacgcctgctac[C/A]gcgggccgcgtttctttgtgcaaa
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) adult erythroblasts MCF10AT1 (breast premetastatic epithelial cells) neutrophils
- ASB for transcription factors
- TCF21_HUMAN KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.05 | n/a | 2.00 | n/a | No Hit | |||
| KDM6A_HUMAN | 3.07 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood