rs12194384 chr6:87925896 G>T
- Sequence
ttcccagccctctgctagctactg[G/T]tgcacatactttacacatgaggag
- ASB in cell types
- MM1.S (plasma cell myeloma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | 1.36 | 0.29 | 1.05 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.71 | 0.76 | 1.10 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol, microalbuminuria, serum creatinine, total cholesterol, urinary albumin-to-creatinine ratio