rs12194795 chr6:84775066 A>C
- Sequence
tctggcactctgggccggagcagg[A/C]gctgtgccccatggcaacccagac
- ASB in cell types
- HCT-116 (colon carcinoma) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 1.56 | -0.89 | 1.38 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -1.49 | 1.84 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis