rs12196167 chr6:139029062 C>T
- Sequence
cgggttggggtcccgtggggcgcg[C/T]gccgcccacgcccccacctctcgg
- ASB in cell types
- BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) | -1.07 | 1.64 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Small_Intestine_Terminal_Ileum, Whole_Blood