rs12196247 chr6:139029045 G>A
- Sequence
gctgggccgagacctcgcgggttg[G/A]ggtcccgtggggcgcgcgccgccc
- ASB in cell types
- K562 (myelogenous leukemia) BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) CD14+ monocytes NCI-H2171 (small cell lung carcinoma)
- ASB for transcription factors
- MGAP_HUMAN EGR1_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MGAP_HUMAN | -3.00 | 3.40 | 1.00 | n/a | No Hit | |||
| EGR1_HUMAN | 0.16 | 2.09 | 1.30 | n/a | No Hit | |||
| SMRC1_HUMAN | 0.15 | 1.77 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Testis, Thyroid, Whole_Blood