rs12197227 chr6:168151121 T>C
- Sequence
gaggagggggcgtcttgaggcctc[T/C]gtcatgccctgggtgccatgtggg
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PANC1 (pancreatic ductal adenocarcinoma) | 0.76 | -0.70 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -2.14 | 2.24 | 1.33 |
Items per page:
1 – 2 of 2